Western Carolina University WCU University of North Carolina Asheville UNCA

Southern Appalachian Digital Collections

Western Carolina University (20) View all
University of North Carolina Asheville (6) View all
WCU - Journeys Through Jackson

Journeys Through Jackson 2014 Vol.24 No.01

  • record image
Copyright Download
  • Journeys Through Jackson is the official journal of the Jackson County Genealogical Society, Inc. The journal began as a monthly publication in July 1991, was published bimonthly from 1994 to 2003, and continues today as a quarterly publication. The journal issues in this digital collection are presented as annual compilations.
  • c < ^ J o u r n e y s T h r o u g h J a c k s o n c T h e Official J o u r n a l of t h e J a c k s o n C o u n t y G e n e a l o g i c a l Society, Inc. Vol. X X I V , No. I W i n t e r 2 0 14 JACKSON COUNTY GENEALOGICAL SOCIETY, INC. 2014 Officers President Kenneth E. Nicholson Vice Presidents Timothy Osment, William L. Crawford Secretary Karen C. Nicholson Treasurer Teresa Deitz Manring Librarian KimberlyS. Shuler Office Manager Ruth C. Shuler Web Master. Deanne G. Roles Computer Technician Jason N. Gregory Chair, Publications (Editor) Sanji Talley Watson Journeys Through Jackson is the official publication of the Jackson County Genealogical Society. Members and non-members are invited to submit genealogical materials for publication, with the understanding that the editor reserves the right to edit these materials for genealogical content, clarity, or taste. The Society assumes no responsibility for errors of fact that may be contained in submissions, and except where noted, the opinions expressed are not those of the editor or of the Jackson County Genealogical Society. The Society accepts no advertising for this publication except for notices from other non-profit groups. From the Editor Well, winter has made it to the mountains, everything from rain to sleet to snow has been seen here lately. But, on the bright side, it has given everyone an unexpected opportunity to work on genealogy. The Society is thriving so far this year with members renewing their memberships, people coming by the office to use the resources that we have and new mysteries coming to light all the time. If you haven't been by the office lately, I encourage you to drop by and see all the new materials that we have. I also encourage you to come to the monthly meetings on the second Thursday of every month. The meetings are always informative and interesting. This fall, in October will be our Semi-annual fund-raiser, so keep that in mind. We will be sending out further information in a few months regarding the activities that we will be having. Journey Through Jackson Winter 2014 _ • T a b l e o f C o n t e n t s Table of Contents, Announcements and Expression of Sympathy 1 JCGS Photo Album 2-6 Webster School Catalogue 7-14 Descendants of John Thomas Tatham 15-18 Genetic Genealogy: The Basics of Using DNA for Genealogy 19-24 People Helping Their Neighbors 25-27 Library Acquisitions 27 Treasurer's Report 28 1880 Jackson County Census 29-32 Ruth Bryson Mysteries « 33-36 1931 Jackson County Death Certificates..., 37-40 Book Review: Green River Graves: Hooper and Related Families 41 2014 JCGS Meeting Schedule 42 WWI Draft Cards 43-46 Index 47-48 L , We offer our sincere sympathy and condolences to the family of JCGS member Eugene McGinnis. We dedicate this issue of JTJ in his memory. We also offer our condolences to JCGS members Mary Jo Hooper Cobb, Peggy Queen Mason , Barbara McCall Mathews, Lynn Allen Bryant and Elizabeth Moss Wilson on the passing of their family members. In the Holiday issue of JTJ, the address for Jean Hayes Cook was incorrect: The correct address is: 165 Grady Wiggins Drive, Otto, NC 27863. O A w a r d W i n n e rs In December at the annual meeting of JCGS the following awards were presented: The Daniel Washington Deitz Award as presented'to William L. "Bill" Crawford. The Robert Lee and Drusilla Holden Award was presented to Irene Bishop Hooper. The Patron Award was presented to James and Jean Scott. Plaques were presented to Dorris Dills Beck and Lawrence "Larry" Morton for their many years of service and contributions to JCGS. Journey Through Jackson Winter 2014 J C G S P h o t o A l b u m W !*<s£q Fowler House and Cottages, Glenville, N. C Altitude 3.500 ft. Modern Conveniences. Golf, Tennis, Swimming, Fishing, Hiking. Not a Hotel, but a Home for Summer Quests. Jean Scott bought this postcard on e-bay, and granted use of it for JTJ. According to Joann Davis Suddreth, the Fowler House was on the point behind the old Glenville School that sat on the lake shore. She remembers that it was still operating in 1965 when she was a senior at the school. The picture below of Robert Lee Gunter and wife Martha Avaline "Mattie" Green and their son Willie Clarence Gunter was also provided by Jean Scott. v J ^J Journey Through Jackson Winter 2014 ^ J C G S P h o t o A l b u m C f ^ ' W K ^ ^ ^ A_—JL,.airiiii.r.iirt. ^ The above picture is of the David Mitchell and Caroline Owen Shelton family. Mitchell Shelton is the tall young man in the middle and the girl in the back row with him is Abia Shelton (never married). The young boy in the front is J. O. "Bud" Shelton and the young girl is Elsie Shelton Phillips. This picture belongs to Carmaletta Gates and she granted permission for it to be used in JTJ. Journey Through Jackson Winter 2014 J C G S P h o t o A l b u m Kj The following pictures belonged to the late Gwen McCall Ashe. allowed us to use them in this issue of JTJ. Her daughter, Kim Ashe graciously K^> The gentleman to the above right is John Harlin Mathis (21 Jan 1842 - 28 Nov 1901). The lady above is his wife Sarah Haseltine Cathey (19 Oct 1848 - 15 Jun 1930). The picture to the left is their daughter Dovie Elizabeth Mathis (16 Apr 1868 - 28 May 1937) and her husband, James Milford Owen (13 Jan 1865 - 4 Apr 1947). V_7 Journey Through Jackson Winter 2014 ( ^ J C G S P h o t o A l b u m _ _ • The picture above left is a son of John H. and Sarah H. Cathey Mathis. Weston Ulysses Mathis (22 Jun 1869 - 23 Feb 1939) and his wife, Martha Jane Owen (25 Oct 1 8 7 3 - 6 May 1959). The man above is Andrew Jackson Owen (3 May 1831 - 18 Sep 1905). The lady to the left is his wife Mary Ann McCall (9 Jan 1832-20Mar 1915). Journey Through Jackson Winter 2014 J C G S P h o t o A l b u m v _ y ^J The picture above is of Andrew Jackson Wood (6 Dec 1816 - 1 Jan 1908) and his wife, Jane Henderson (1819-1915). The picture to the upper right is of Melissa M. Luker (26 Mar 1899 - 22 Nov 1918), the daughter of Charles Benjamin Luker and Sarah Ann McCall, and her husband Shelvin Owen. The couple to the right is John Lee Shook (27 Mar 1884 - 20 Aug 1965), and his wife, Mary Elizabeth Galloway (14 Feb 1883 - 3 Jan 1964) ^J Journey Through Jackson Winter 2014 _ W e b s t e r S c h o o l C a t a l o g u e The catalogue below was sent to the Society by Gary W. Hines of Louisville, KY. The catalogue predates a gift of the 1916 catalogue shared by Betty Raby Rowland. _ * _ Journey Through Jackson Winter 2014 MjMaw^.iw<immm&#s^i : - ^ v ^ t . J U ^ •j&mvv^-*-^ ' • • ' " • • . • . > ^ • ^ if* •• ..^ypL'•-"•• • "•*.;'.••.,' ...„•,.>'-'. /"-.'.-, !^-; : - ;- . ; a . v.-•_.:*. - - • - ^ •-'--'•'.•-. ••*:••• - . • v ^ V J v ^ Journey Through Jackson Winter 2014 C 'fV."'\ c ^ «-. • •'?& •;.-'• - ^ ' -. • .^'BAXfaCc, J(MES, -.:. • ;.. , ^ - * . - . ^ * ^ v , ^~;'<V-VYr ' T .-Maihetoa^icc^ScieTQoe; Histbryi . •'' ' '"'""-• I f ?-'''"''• . ^ ' - ^ i S ^ ^ V i v:.-;75>^?'"'""-/.-..--ir "•"•• •-•-;_. i'k-.."C':!.-.. / ^ ^ ' ^ ^ S ^ k l ^ J l A D S g H C " ! ' . .*;*SSL^ ,;. ..%^>;:*,. - Journey Through Jackson Winter 2014 r _ _ 3 _ a e _ ^ > ^ v 5 & _ ^ ^ & _ J W S H 5 B * 1 _ & * ^ _ ^ W v ^ v _V 10 Journey Through Jackson Winter 2014 ^ C - '•x-;sgi*3 &~M -v>H^; *€^5 5m ' i i ' j Bfl&Bjf *-,^ *•" jfrtfe: 4 J' E**' r.^a^4 3 ^ _ •*&.• .^fes r « - - • : • . ^ , f f i g d o n t l ^ ^ ^ ^ : : r ; " ^ : ^ "\::' "*•"-"£" : i Moore, -Erei^ ."V Vr'i • •i•5J.Vi-*&_f^SJW^il_*^i••>•'•••'•'••• -* '** i* V* ._•* 'ft ^_Sf_s_iMc*L9^ *rr»-»- ' 2 > • ^ r - p ^ i i r t e f W&&_f- > ^ •-- * \ ^ * ^ - - ; Biifiwellj Stallwefif <i,=i .•* I' '.. iU,: SfVi i'Gieb? tir" "*: >£$ :.^fi *•$» _ J" ^^ *• ' ^ . H ^ ' ^ ^ V^ m -r«*.!; - *:'•* .«t«^?v > & & & »fl_ ^ . * :yss> C Kwi.-.: 5 ^ 4 £i"*8S#_li 11 Journey Through Jackson Winter 2014 - ^ ^^X :,--^ • '"."• Ethel""1:.. / \ * ">: <&6e/ltoy ~' - " - " - - - ^ . V ^ > > . ^ ^ ^ ; W i l J i ^ , w r - : i>; •iah,---0' ' - ^ • • ^ • ' - ^ - - " ^ m f e e ^ . ^ T ^ ^ Wi* i^^v''.»••»*' i ^ ^ . v ..... v- /.. ^....v. •*.•_.vE?^y^«!^ai»!S!,»t^*KS»fca»a*v-.«»i*. -Suit:- .:-»f » -*.*•<*& •H- -V-f^-- g ' ^ - A f ^ t ' t ^ - ' ':• 'J'y- v. - i - ^ r ^ ^ u m g ^ r n e r , ! } ^ ^ •;-*•, ".'• * "-- * ^ ^ ^ , ' ••;;. • ; : - ^ ; . • . c . \ J KJ ^ J 12 Journey Through Jackson Winter 2014 _ • ^ _ • !«£. '*"•• , 2-!- i''^P^f?^^ •> * ii Zxtr*^ ~„ WEBSTER fficn SCHOOC*; - * -".. " *>•• •:, '• ^ * e f x r , . ^- ^ # # g ng. Amd© - Mathis^Tesi - V*r^J^raii?;-€arVi& ^ „-s ;-» •McG»dM&.., _ . iEvang,Nina , m " McConneu*, Ff0& 'X••, - ,, • ~*'jFiHlbrj^it, Bcpnie * -* MeCoin^elk'jE^^i,-- > ^ i j K § $ r t , -George' x- Moore.- «<toai4 „;•*.. ^, •? - ; - > ^ , rtaaapit.Jlay - ^ > * r ^ntlfiKiit, Minme ^ %" . Tmlbjr^t?.NanBie 'pillbfi4ht Nellie • F ^ t o t h t , . Nettie F a l l b n ^ h ^ n th r~, ^^^Jil,l|nden ft^!__toaB<MB<_ " - - ' a ^ufua •'W<; *f' Moore*''ESggjsr; . ' M o o rA l ^ ! ^ ^ : ? 5 f e , v'; MoorejMer£;; '^'^'-^S';:;-;.^ Moore, Myrtlt^." ( . ^ Morian*t3_fi*a^. ' 4jr; ' •^.^Y.-'y* Mos%^allfe:^n^Y^r: •'"•""'-J-1"i* JFenklls. Herds »KBeiUl_ Painter,'i Pain! P a r k ^ b a ^ '.'..rt--'.'--.-' " *K$ B^ttes • « ? * • i 'Bams ; **^J*' ^u f*>i •J^*5 ,PmihofflIlw^ae^:i; •< ^ ^ i ; . *- Proffit&H&ttie ' ; ^ • ^. . r-<- ^ ^ ^ f V p^offitt, Ruth> . ; ;•'•.' ; . - ^ ^ " r -" * ^Rogers,^arir-; ; - - V ^ ^ ^ ^ ^ - - ; u ; - Rogers j a a t ^-: • ' ^ i ^ a ^ K K " ""•'" S t o r U l v E d u ^ ; ; * | ^ ^ Sherrill;' R « ^ ^ ^ ^ ^ S g a » l ^ . i : . , ^ j Smith, vJessiJf ' Stiles," Dewl&l --' •T1-t "-1- -a• -'.*•T:-a!•r-.« <•-!• ;.•-mi*r,."-^'^*~V..J rS*-'5w' ^^ •_JSfc_&_M_2*iB*WK!'Jv'W ^-v * .*. •• 1- :-:^^vi^i^im^W$^- ':•••.., '' "'-' • - > ; ^ ^ ™ M _ l _ * ™ C r ; U —i—MA­IS Journey Through Jackson Winter 2014 \ J K J : £-^*.".k*\'* ^ . i ^ A^ K J 14 Journey Through Jackson Winter 2014 < w ^ D e s c e n d a n t s o f J o h n T h o m a s T a t h am ED: This was submitted by JCGS member, Mary Buchanan Smith. It will continue in following issues. MACON AND JACKSON COUNTY LAND RECORDS: Bk. A., Page 382,1836 ... '180 acres for $10.00 per 100 acres on waters of Savannah Creek. Bk. A. Page 512, 3 Dec 1845. William Tatham to Warren Barker, for $30. . ., East side of Savannah Creek, Tatham interest in land with John Wilson and Company . . . (description runs on Buchanan's line.) 100 acre. Bk. C , pg 1354, 1841 for $300.00 pd by Wm. Tatham to Richard Wilson (Hs father-in-law) in year 1840 a parcel of land on Savannah Creek. 85 acres. Bk. C , pg'1354, 27 Feb 1841. Jacob Sims of 1st part and John Wilson, (Brother-in-law) and William Tatham of the second part for $100.00 containing one hundred acres including a mill, also 100 acres . . . 260 acres in all. Bk. D., pg 1738, Feb 1844, for the sum of $10.00 sold unto Isaac Ashe a parcel of land on Savannah Creek beginning at the mouth of the Hollow below the Ridge, by estimation 40 acres or more . . . Bk. D., pg 1724 10 June 1844. James M. Tatham for sum of $100.00 by William Tatham . . . sell and release unto Wm Tatham land on the waters of Chattooga River near the White Side Mountain in 18th District of Macon County containing 100 acres. W ' Bk. D., pg 122, 15 Aug 1846. Between John Wilson (William's brother-in-law) and William Tatham for $30.00 on the waters of Savannah Creek, 100 acres with the exception of 10 acres marked off and granted for the purpose 6f a mill site. 25 Jul 1848. Between William Tatham and George Bumgarner for the sum of fifty dollars a tract of land on Savannah Creek in County of Macon containing 50 acres. Bk. 1, pg 32, 1853. William Tatham - Methodist Church (By trans.) 10 Mar 1853 between William Tatham, Isaac Ashe, Amos Ashe, Christenbury Webb, George Bumgarner and William Tatham, Trustees for Church grounds and building and appurtenances there on known as the Weslannah Church or Savannah Church for the use and benefit of the members and minitsers of the Methodist Epispocal Church and their successors in office as they may be appt. by proper authorities of the Church as inheritance forever... on waters of Savannah Creek on the North side of Tatham's Mill Race. William Tatham and R. V. Welch File 431, Grant 407, Entry 136, Bk 162, pg 293, 3 May 1853, 384 acres Savannah Creek File 209, Grant 287, Entry 135, Bk 160, pg 559, 3 May 1853, 640 acres Savannah Creek near the head of Sang Branch. File 522", Grant 498, Entry 133, Bk 162, pg 572, 3 May 1853, 350 acres on Savannah Creek at J. L. Tatham's Corner. File 523, Grant 499, Entry 141, Bk 162, pg 573, 2 May 1853, 640 acres on Savannah Creek. (Tatham and Welch) marker in Wilson's line . . . Hall's line . . . Wilson's Corner . . . Quilliams line . . . passing Green's line. File 524, Grant 500, Entry 134, Bk 162, pg 573, 3 May 1853, 640 acres on Savannah Creek. File 525, Grant 501, Entry 142, Bk 162, pg 573, 3 May 1853, 640 acres on Savannah Creek. 15 v _ y Journey Through Jackson Winter 2014 File 538, Grant 504, Entry 143, Bk 162, pg 575, 3 May 1853, 640 acres on Savannah Creek. Bk. 1, pg 109, 1854. William Tatham sold to William H. Higdon, land on Savannah Creek for $35.00, 100 acres entered 29 Mar 1846. March 1853. A Court of Pleas and Quarter Sessions is opened and.held for the County of Jackson at the dwelling house of Daniel Bryson, Sr., the place fixed by law for the holding the first Session of said County Court. On the motion William Tatham was appointed as one of the Justices of the Peace in the county. William Tatham Commissioner of the Town of Webster is allowed for service $2.00. Bk. 1, pg 109, 1854. 18 Mar 1856. William Tatham, 1st part and Wm. F. Passmore 2nd part. William Tatham for consideration of $12.00 to him in hand by the said Wm. F. Passmore, Jr. his interest in a piece of land lying in Jackson County consisting of 1/3 of one undivided interest in same, which lands are lying on the waters of Chattooga River. Certified 8 Apr 1856. Pg 533, 24 Apr 1856. Whereas William Tatham has heretofore by entry obtained an interest in Entries #862, 640 acres; #103, 350 acres; #134, 640 acres; #136, 384 acres; #137, 640 acres; #141, 640 acres; #142, 640 acres; and #143, 640 acres lying in the County of Jackson for consideration of the sum of two hundred dollars to William Tatham in hand paid has contracted and sold to James Tatham and F. Leach off the County of Cherokee on the sixth of said entries on condition that they pay the said Tathm the sum often cents per acre for one sixth part of the afore said entries and costs of surveying and contingent fees there and then and the case Tatham obligtes (sic) himself to convey to John Tatham and Leach on undivided sixth part of said entries. Bk. 1, pg 494, 18 Mar 1856. William Tatham of State of NC and County of Macon for $30.00 paid by Warren Barker a piece of land on the east side of Savannah Creek, in Dist. #8 being said Tatham's interest in the land with John Wilson and Company. Entered 2 May 1836. Estimated 100 acres. Bk. 2, pg 6, 12 Sep 1856. Between M. Francis, Wm. Tatham, N. Woodfin of Is' part and Wm. Passmore Jamison of 2nd part for $60.00 paid in hand by 2nd part to parties of 1st part, the parties of the first part have bargained and sold premises, releases and quit claims on land in County of Jackson formerly Macon on the waters of Chattooga River near Whiteside Mountain. Bk. 2, pg 358. William Tatham to Robert Phillips of Macon County V2 of 1/3 of Entry No. 137, 141,134 and 145, and Vi of 1/6 of the Shell Ridge 640 acre tract. Said Tatham Acknowledges the amount of $85.00 paid in full. Sum paid above will be more or less than 10 cents per acre. William Tatham died in 1858 without a will. His estate had to be settled in federal court in Morganton, Burke County, NC. Jackson County Register of Deeds This indenture made this the 10* day of May in the year of our Lord, 1860, between E. D. Davis Esq. High Sheriff of the County of Jackson and State of NC of the one part and John Wilson of Jackson Co. NC of the other, part witnessed by virtue of two executions issuing from the county Court of Jackson against Joseph Keener and William Tatham for the sum of $263.58, which sum was recovered by John B. Allison chr. of the said Joseph Keener and William Tatham as on record may appear. Whereas the said execution was directed and delivered to the said E. D. Davis, Sheriff as aforesaid Commanding him that of the goods and Chatties lands and tenements of the said Joseph Keener and >_y William Tatham he should cause to be made the aforesaid sum of $263.58 to satisfy the said Execution 16 K J ^ c ^ Journey Through Jackson Winter 2014 with the cost thereon and the said E. D. Davis Sheriff did seize and take into his hands and custody no goods nor chatties to be found a certain piece or parcel of land in the County of Jackson bounded as follows beginning on a Black Oak N. E. corner of No. 158 and runs North seventy Five West 105 pole to a Black Walnut thence south Twelve west sixty three poles to a White Oak thence South forty poles to a stake on Savannah Creek at Bumgarner's N. W. Corner thence down the meanders of Savannah Creek ninety five poles to a Beach Bumgarner's N. E. Corner thence south Twenty five west twenty one poles to a dogwood thence east twenty five poles to a Hickory thence South forty poles to a Chestnut thence East fifty eight poles to a Red Oak thence North seventy poles to a Hickory thence seventy eight poles to a Black Oak thence North five East one hundred poles to a Lynn (sic) at the Stillhouse Branch thence West down said Branch fifty poles to a Maple on bank of Savannah Creek then North west eighteen poles to a Stake at a Bridge on the State Road adjoining the Wilson old tract then south seventy two sixteen poles to stake thence N. fifty five w e s t . . . containing one hundred and seventy nine acres the lands on which the Widow Tatham now lives and the sheriff after due advertisement according tq,law did cause the piece of land with all appurtenances be put up at public sale to the highest bidder on the 20th day of March in 1860 at which time John Wilson (Brother to Isabella Tatham) became the last and highest bidder at the sum of twenty dollars for the lands with appurtenances belonging to William Tatham deed. Isabella Wilson is the daughter of Richard Wilson and Racheal Strain. She was born on 1 Jun 1802 in Buncombe Co., NC. She died on 3 Oct 1889, in Jackson Co., NC. Burial in Wesleyanna Cemetery, Jackson Co., NC. Notes for Isabella Wilson 1860 Census, Jackson County, North Carolina I. Tatham J . L . T.N. J.M. D.J. 55 22 20 18 18 female Farmer male male male male William Henry Tatham .and Isabella Wilson were married on 12 Jan 1826, (Ref. Bible of John & Ann Tatham.) 15. i. Elizabeth Araline Tatham. She was born on 2 Apr 1827 in Haywood Co., NC. She married George Bumgarner on 27 Feb 1847 in Macon Co., NC. She died on 24 Aug 1903 in Jackson Co., NC. Burial in Fairyiew Memorial Gardens, Jackson Co., NC. 16. ii. Lucinda Tatham. She was bprn on 1 Aug 1828 in Savannah Jackson Co., NC. She died 5 Jul 1892 in Savannah, Jackson Co., NC. Burial in Weslyanna Methodist Church Cemetery, Jackson Co., NC. 17. iii. Clarinda Tatham. She was born on 16 Feb 1830. She married Robert A. Phillips on 13 Oct 1853 in Jackson Co., NC. She died on 3 Oct 1920 in Macon Co., NC. iv. Alpheus L. Tatham. He was born 22 Nov 1832 in Macon Co., NC. He died in 1854. Notes for Alpheus L. Tatham Macon County Land Records Grant 1144, 23 Dec 1843, Issued 11 Feb 1853, District 11, Section 158 (Jackson County, NC) on Tatham's Creek, on the waters of Savannah Creek, adjoining William Tatham. Grant 1145, 12 May 1847, Issued 11 Feb 1853, 100 acres on Savannah Creek (probably same as Bk. G, pg 52.) 17 Journey Through Jackson Winter 2014 Bk. G, pg 52, 1853. Altheous Tatham, 100 acres on the waters of Savannah Creek v-^->' beginning at a popular (sic) tree . . . runs by Luke Wilson's corner. Jackson County Minute Docket - March Term 1856 Invoice of Estate of A. L. Tatham by William Tatham, Administrator. Trivit (?) on Stephen Munday, 53.00 2 Watches 108.00 1 bolts refroster (?) 30.00 John B. Allison debt for 150.00 William E. Enloe 50.00 Benjamin Allison 10.00 J. B. Love 1 shot gun 140 acres of land William Tatham, Administer - Certified by D. Rogers, Clk. "Family History" said that Lee Tatham was arrested for forcibly taking mail from letter carrier between Dillsboro and Franklin because he was expecting a letter from a woman. He was arrested and jailed in Macon County, NC Jail and there died of the "Bloody Flux". (Told by Mattie Buchanan Cabe, daughter of Lillie Tatham Buchanan.) 18. v. Racheal Minerva Tatham. She was born on 24 Jul 1834 in Macon Co., NC. She married Jesse Jones in 1856. She died before 1875 in Jackson Co., NC 19. vi. James Lafayette Tatham. He was born on 18 Jul 1837 in Macon Co. NC. He married •^^J Catherine Boyd on 9 Jun 1861 in Jackson Co., NC. He died on 14 Mar 1919 in Jackson Co., NC. Burial in Wesleyanna Methodist Church Cemetery, Jackson Co., NC. 20. vii. Thomas Nathaniel Tatham. He was born on 4 Jun 1839 in Jackson Co., NC. He married Artie Mae Bryson on 15 Feb 1865 in Jackson Co., NC. He died Sep 1919 in Young Harris, Georgia. Military Service: CSA, CO. A. Infantry Regiment, Thomas Legion. He is buried in Young Harris, Gerogia. 21. viii. David Jasper Tatham. He was born 15 Apr 1842 in Jackson Co., NC. He married Mary Collins Pilky on 22 Mar 1866 in Jackson Co., NC. He died 17 Oct 1891 in Jackson Co., NC. Burial in Wesleyanna Methodist Cemetery, Jackson Co., NC. 22. ix. John M. Tatham. He was bom on 15 Apr 1842 in Jackson Co. NC. He died on 26 Jun 1862 in Mechanicsville, VA. ^ y Journey Through Jackson Winter 2014 _ • O ^ | G e n e t i c G e n e a l o g y : T h e B a s i c s o f U s i n g D N A f o r G e n e a l o g y ED: This article was written by Emily D. Aulicino, for JTJ. She has worked for several years as administrator for 13 different FTDNA DNA projects. She is the Northwest Regional Coordinator and Speaker for the ISOGG. She has spoken all over the world at numerous seminars and workshops concerning DNA. She is the author of Genetic Genealogy: The Basics and Beyond, which is now available from your local bookstore. We are extremely lucky and honored that she agreed to write this article for our society. DNA has been a household word for years. Many genealogists are turning to DNA testing to correct their paper trails, prove or disprove family oral history, find cousins who can assist with the research, and just for curiosity. Many adoptees have been successful in locating close family and even siblings and parents. Regardless of your level of interest, understanding how DNA testing can help you with your genealogy research is a must! DNA testing is the most accurate tool a genealogist has. However, a small percentage of people who test discover the biological surname is different than the one they know or a cousin may not be a cousin. Therefore, do not test unless you wish'to know the truth about your lineage. To the non-scientist, TJNA can seem overwhelming, but you do not have to have a science degree to understand how to use it for genealogy. Like every other field, a few terms will help you better understand what you hear and read, and repetition is the best way to learn. How does DNA testing work with genealogy? Every cell in our body contains a copy of our entire DNA. DNA is not a living substance but a combination of chemicals with instructions to create our bodies. Our DNA is inherited from our ancestors so we only need to test living persons. We receive 50% of our DNA from our father and.50% from our mother, just as they did from their parents. What is inherited depends upon which DNA test is taken. Each type of test tells you something different about your lineage and can be used to help solve particular problems. Understand that a well-documented genealogy is needed to use DNA testing to help. DNA testing without a genealogy is a pile of numbers. A genealogy without DNA testing is mythology. When you test your DNA you are matched to other testers with whom you share a common ancestor. The phrase "common ancestor" is used in genetic genealogy (use of DNA for genealogy), but it can be misleading to some people. Understand that it actually means "the most recent ancestor that we share". The person you match may have a documented family tree that could add to your information. By working together you can focus on the missing generations between your families to link to that common ancestor and perhaps go beyond that brick wall. DNA tests rule out persons who are not a genetic match, allowing you to focus on lines that are definitely related to you. Why should a genealogist take a DNA test? Every genealogist feels they have researched their lineage and it is correct. They have worked years locating the records, interpreting them with skill, using circumstantial evidence only when needed, and understanding that any record can have inaccuracies; they have done the best job possible in constructing a paper trail. However, DNA is the most accurate tool a genealogist has available. DNA testing can tell you who is related to you and who is not. It can help adoptees find their biological cousins and sometimes their parents and siblings. It helps find others who are researching the same lines and by work together you can further your lineage since some of your matches may have more information'than you, or they may be able to share photos and family stories that may be new to you. DNA testing can help you solve brick walls and go beyond the time when the paper trail ends. It can help you correct your paper trail as all genealogists know that man-made records have potential errors. 19 Journey Through Jackson Winter 2014 Essentially, DNA testing can help you break through your brick walls, further your research, correct your paper trail and find cousins with whom you can share information. Types of Tests Three general types of DNA tests are used for genealogy. Each provides information for different parts of your genome and can be applied to different parts of our pedigree chart. It is important to understand what problems can be solved by each and to test the correct candidate in order to solve the problem or reach your goal. Y-chromosome DNA test The Y-STR DNA test traces the patrilineal line (the top line of ancestors in a pedigree chart). This is an excellent test to help locate the biological surname for those men who suspect someone on their all-male line was adopted, illegitimate or had a name change. The Y-STR test is the easiest test to use for genealogy, but only males can test since women do not have a Y-chromosome. The Y-chromosome, located in the cell nucleus, is handed down from father to son virtually unchanged since mankind began. From time to time a few changes do occur. These care called mutations which, in this case, does not harm the species. For this reason two people who take the same test can match each other if there are not too many mutations. Each company determines who matches whom within their own database of testers. Those testers who match each other share a common ancestor somewhere back in time along their all-male lineages. That common ancestor handed down his DNA to all his male descendants. Each company that provides the Y-chromosome test determines who matches whom. The test results are a group of numbers, one for each location along the Y-chromosome that is tested. (If you order a Y-37 DNA test, then 37 locations are tested.) In the following example, the top line of the chart is the name of the markers and the next rows are the results for Tester 1 and 2. Each number for a marker is the total number of short tandem repeats (STRs). KJ \ ^ DYS Tester 1 Tester 2 393 14 14 390 22 22 19 10 10 391 14 14 385a 14 14 385b 16 15 426 11 11 Our DNA is made up of four basic chemicals, adenine, cytosine, guanine, and thymine. These bases form a pattern such as AGTA. This short pattern is repeated consecutively, hence the name Short Tandem Repeat. If there are 5 repeats ((AGTAAGTAAGTAAGTAAGTA) the number for the result of that marker will be five. In the example above the marker 385b has a 16 for Tester 1 and a 15 for Tester 2. This means the pattern repeated itself 16 times for one tester and 15 times for another. This is a mutational difference, often referred to as a genetic difference. It is not important if the number increases or decreases. Mutations are random and can happen in any generation. They can also go back to the original number in a later generation. What is important is that there are not too many mutations between testers so you have a recent common ancestor. Mitochrondial DNA test The mitochondrial DNA (mtDNA) is located outside of the nucleus of a cell and is handed down from mother to all of her' children. However, only the daughters can pass it along to the next generation. For this reason both males and females can test their mtDNA and learn more about their mother's matrilineal line (bottom line of a pedigree chart). u 20 ^ c o Journey Through Jackson Winter 2014 The mitochondrial DNA is found in abundance throughout our cells, and along with its small size, it is an excellent candidate for forensic studies of old or degraded samples. Many archaeological studies of ancient DNA samples, which are thousands of years old, focus.on mtDNA testing. Due to its abundance, the likelihood that mtDNA survived in ancient human remains is much more probable than the possibility of finding any nuclear DNA (i.e., DNA in the nucleus, such as Y-DNA) in an ancient sample. Many ancient remains have had their mtDNA tested, such as Otzi the Iceman, the frozen mummy from 3300 B.C.E. found pn the Austrian-Italian border who is haplogroup Kl; Cheddar Man, a skeleton found in the Cheddar Gorge in England who is haplogroup U5; and Empress Alexandra Fyodorovna, wife of Tsar Nicholas II of Russia who is haplogroup H. For a list of Famous DNA, see the International Society of Genetic Genealogy (www.isogg.org). The mtDNA test tells you about your deep ancestral lines and is much more useful anthropologically than genealogically. Since mtDNA mutates very slowly, it can be difficult to use for genealogical purposes. Anyone you match, even on the entire mitochondria, can have a common ancestor with you a thousand years ago or more. But according to Family Tree DNA, an exact match on the Full Mitochondrial Sequence (FMS) is at a 90 percent confidence interval for 16 generations or about 400 years. This must be viewed with caution as every family mutates differently and the number of years between generations in a family varies. Because of this, most genetic genealogists have less success using the mtDNA tests than with the other types of DNA tests. With careful genealogical research and the selection of qualified female descendants for testing, mitochondrial DNA has been used successfully in solving more recent genealogical problems. To find connections in recent times, it is necessary to locate and test multiple people with the full mtDNA sequence (FMS) who have a suspected shared ancestry. This is done by careful examination of traditional genealogical records. Making connections with people in genealogical and historical interest groups can be helpful in locating viable testers; The process for using mitochondrial DNA to go beyond the difficult situations in genealogy can be illustrated in an attempt to find my fifth great-grandmother. This all-female line comes to a dead-end at my fourth great-grandmother Frances Watson. According to a short newspaper article published when Frances was living, she was born in Madison County, Kentucky about 1788,.and at age one, her family returned to Albemarle County, Virginia where they had lived before moving to Madison County. In 1790 a Jesse Watson died in Madison County without a will and tpld two witnesses that "his wife Milley and his Heir appearant [sic] should enjoy what he had equally between them". Jesse's wife, Mildred Ballard, moved back to Albemarle County at about the right time. Is she my fifth great-grandmother? On March 7, 1808 "Franky Watson, orphan of John Watson personally appeared in Court and makes choice of Dabney Ellis as her guardian who gave bond and security accordingly." March 10, 1808 Dabney and Frances were married. There are five John Watsons in the county and each with a daughter named Frances or Fanny. None are the correct Frances. Did the county clerk became confused with all the Johns who each had a daughter Frances marrying about this time or is Jesse Watson of Madison County really Jesse John or John Jesse Watson who elected to use Jesse as his given name for a while? To prove that this is the correct line, an all-female line from Mildred Ballard needs to be located as she was the wife of Jesse Watson. After returning to Albemarle County, Mildred married David Craig but only'had sons by him. I searched the descendants of Milley's sisters to find an all-female line to bring to the present for testing, but I have not been successful so far. The next step is to go back one more generation to Milley's mother whose maiden name was Johnson. To prove a connection, a living female who descends on an all-female line from a woman in this Johnson family (Milley's sister's all-female descendants) must be located and tested. If she and I, the descendant of Frances Watson match, I have just won the DNA Lottery! 21 Journey Through Jackson Winter 2014 Autosomal DNA test v _ ^ Autosomal DNA (atDNA) is the DNA of the non-sex chromosomes which are called autosomes. The markers tested in a typical atDNA test are distributed throughout all the chromosomes across the genome. Autosomal DNA is a somewhat random combination of all of the genetic information passed down to us from all our biological ancestors. During meiosis we received our genetic data from both of our parents, 50 percent from each. Each child inherits different segments from each of their parents through independent assortment. (Mendel's Law of Independent Assortment states that separate genes for separate traits are passed independently of one another from parents to offspring.) The DNA that is inherited determines a person's unique identity and appearance, making them the distinctive person they are, while at the same time making a person similar to their parents and siblings. Autosomal DNA gives a person their physical features, and it may contribute to their personality. Although identical twins share the same DNA, testing particular places in the genome can denote differences between them as well. (See http://www.scientificamerican.com/article.cfm?id=identical-twins- genes-are-not-identicaD Anyone can take an autosomal DNA test and match either males or females. With this type of test, matches are usually found within six generations of the tester, but may go back further. For example, if a person is number one on a pedigree chart, the sixth generation would include his or her sixty-four fourth great-grandparents. If every one of their descendants took the atDNA test, there could potentially be thousands of matches, and all would be cousins. As good luck would have it, not everyone has tested. Imagine the daunting task to discover all the common ancestors. Most people have several hundred matches, especially if their ancestors have been in the United States for the last 200 to 300 years. Populations who are endogamous (marry within their ethnic, class, or social group) such as Mennonites and Jews may have well over 1,000 matches. However, my husband, whose forebears came from Italy in the early 1900s, has only ten matches. The number of matches can be a result of which populations have tested and whether they are an endogamous population. v_y Mathematically, this type of test cannot guarantee a match beyond six generations; however, common ancestors between matches have been discovered further back than this. As the technology improves, the capability of reaching beyond the sixth generation with regularity is very probable. If a fourth great-grandparent gave his child 50 percent of his DNA, then the grandchild of that fourth great-grandparent would have 25 percent of the grandparent's DNA. In only a few generations the percentage of DNA from any fourth great-grandparent is reduced, and a person may not carry DNA from all of their ancestors at ten generations back, although they can carry DNA from some ancestors who are 10+ generations removed. For details on inheriting single segments of DNA from very distant ancestors, see Steve Mount's blog, On Genetics, at http://ongenetics.blogspot.com/2011 /02/genetic-genealogv-and-single-segment. html. (See "Appendix D, Autosomal Statistics" for the chart "Average amount of autosomal DNA shared with close relatives".) There is an exception, however. If your ancestors married cousins, you would have a higher percentage of DNA from their ancestors than from your other ancestors in the same generation. For example, my paternal great-grandparents were first cousins. I was listed as a third-cousin match with another tester. Once I discovered who the match was, I knew where we were connected as we had been corresponding decades before DNA testing existed. We were not third cousins, but seventh cousins. I have more DNA on that line because my great-grandparents share the same ancestors so the relationship appears closer. I have also found a ninth cousin from autosomal DNA test results with a predicted range from fifth cousin to distant cousin. That 9th cousin and I could be related more recently on a different line that we have not yet discovered. With the randomness of atDNA, it could be possible that we are just ninth cousins; it could also be possible that there was an ancestor in that line who married their cousin. Although an autosomal DNA test covers all the lines in a six-generation pedigree chart, it does not replace the Y-STR or mtDNA tests as each has its own purpose and tests different lines of the pedigree chart. Generally speaking, Y-STR and mtDNA testing will reach much further back in time along the all- \_y male and all-female lines, respectively. An autosomal test is an excellent tool for proving or examining 22 o L f - c Journey Through Jackson Winter 2014 relationships within the last six to eight generations generally. With the atDNA test, you can also determine which ancestor gave you which DNA segment through a process called Chromosome mapping. Choosing a Company Currently, there are three major DNA testing companies for genealogists. Each uses the same chip for testing, but otherwise they vary greatly in their offerings. To choose the best company for you, there are several questions you should ask. Any company will tell you how good they are so speak to people who have tested with all of the companies by joining the International Society of Genetic Genealogy (ISOGG) and their Newbie e-mail list to ask any question. Joining is free and your personal data is not shared. Visit www.isogg.org. 1. How established is the company? 2. Can you contact the company easily? 3. How is the company's customer service? 4. What is the world distribution and size of the company's database? 5. How accurate is the testing? 6. What tests are available? 7. Will my DNA sample be stored so the test can be upgraded? 8. Can'the testers you match be contacted easily? 9. What is the cost of the tests? 10. What does the consent policy say? The quick summary of each company below can assist your decision. All companies have sales, some more often than others, but do not let price be your determining factor. Remember: There is hardly anything in the 'world that someone cannot make a little worse and sell a little cheaper, and the people who consider price alone are that person's lawful prey. — John Ruskin (1819-1900) (Note: This quote is on the wall in every Baskin Robbins ice cream store, but sources indicate the author of this statement is not necessarily John Ruskin although credit is given to him.) Family Tree DNA (FTDNA) (www.familvtreedna.com) • Is the oldest genetic testing company for genealogists • Tests several levels of Y-DNA (Y-DNA12, Y-DNA25, Y-DNA37, Y-DNA67 and Y-DNAlli), mfDNAPlus (HVR1, HVR2) and the full mitochondrial sequence (FMS) • Tests autosomal DNA • Tests single nucleotide polymorphisms (SNPs) • Provides names and e-mails of your matches • Provides features similar to 23andMe, such as Chromosome Browser and Population Finder • Allows you to download raw data and all your matches into Excel or similar software • Does not sell your results to scientists or other researchers for a particular project without your consent • Sells all tests world-wide • Accepts DNA results transfers from other major companies 23 Journey Through Jackson Winter 2014 23andMe (https://www.23andme.com/) • Focuses on health, but offers features for genetic genealogists • Tests only atDNA, but gives haplogroups for Y and mtDNA • Requires use of their website to contact your matches (If your matches accept genome sharing requests, you may compare your results with theirs.) • Provides features similar to those at Family Tree DNA's Family Finder with some additional features as well • Allows you to download raw data • Does use your DNA results for research and has recently been awarded some patents on their research • Sells their test in 56 countries, but the shipping costs are very expensive for anyone outside of the U.S. Ancestry.com (nttp://dna.ancestrv.com/0 • Offers limited markers for Y-DNA and mtDNA testing, but does not seem focused on these at the present • Does not do SNP testing so haplogroups have been erroneously reported • Tests atDNA using the same chip as Family Tree DNA and 23andMe, but does not include health markers • Does not allow you to see the shared DNA segments, as do the other companies through their chromosome comparison features • Requires an Ancestry.com membership and a "public tree" for best results in contacting matches • Requires the use of their website to contact matches • Your DNA matches are compared against your matches "trees" and where a common ancestor exists, you are notified in a "shaky l e a f logo. Although the DNA test is accurate, the matching system can be in error, especially for more distant relationships, since there is no chromosome comparison feature to compare DNA segments. Ancestry reports only the closest common ancestral pair no matter how many common lines you have with someone; therefore, if you match a person in more than one way on your tree, such as being related to the same ancestor in two different ways through cousins marrying, that will not be represented and cannot be verified by their system. • Allows you to download the raw data • Does not sell their atDNA test outside of the U.S. currently KJ ^J K J 24 Journey Through Jackson Winter 2014 O P e o p l e H e l p i n g T h e i r N e i g h b o r s ED: This ledger was brought into the Society by Harry Sumner. The Crawford Sumner mentioned in the papers was his grandfather. He estimates that this was before 1944. People here in the Southern Appalachian mountains have a long-standing tradition of helping their neighbors in times of need. The following employees of the paper mill were continuing this tradition by pledging to help their neighbor. In today's times the amounts pledged don't seem to be a lot, but at this time, these amounts were substantial. We the undersigned, agree to pay the amounts opposite our names for the benefit of Crawford Sumner. As everyone knows he has been in hospital very sick, and will not be able to work for several weeks. _ • O Ron Talie D. A. Norman V. G. Blanton M. V. Sims Ethan Cagle E. Harrill H. H. Cope Jess Brown W. Painter Roy James C. G. Bryson George Conner Henson Charlie Stewart Ernest Jones Clint Bryant A. D. Wood W. A. Franklin H. R. Fox C. E. Smith J. L. Clement J. J. Patterson Hubert Harris J. H. Deitz Ham Ashe Will Norman Willie Barnes Albert Bumgarner Will Fox Dewey Blanton Floyd Sumner ($3.00 of store balance C.B. Fox Hermand Ashe W. H. Bumgarner W. B. Morris C. Nicholson paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid -gave paid paid paid paid paid $1.00 1.00 .50 1.00 1.00 1.00 .50 1.00 .50 .75 .50 .50 .50 .50 .50 .25 1.00 .25 1.00 1.00 .50 .50 1.00 .50 1.00 .50 .50 .50 .25 .50 5.00 $2) 1.00 .35 .35 1.00 .50 J. C. Middleton Willie Bramlet Charley Lomanac O. H. Cabe J. L. Henson Jake Frizzell Bedford Ensley Lon Cunningham Burgle Shuler C. O. Harris T. S. Shuler Gordon Stanford Hubert ? Claude Jones OraAkins Z. V. Parris C. O. Vance J.B. ? Lee Walker G. S. Lewis Emerson Phillips A. Robinson J. E. Buchanan Frank Barns Tom Evans Loy "Curly" Bryson D. D. Blanton H. G. Cabe G. S. Kilpatrick J. M. Dillard Earl Hurst Engel Wood Bob Painter T. J. Painter E. G. McCracken Dick Greene C. J. Cowan paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid .50 .50 .50 .50 1.00 1.00 .50 1.00 1.00 .50 1.00 .25 .75 .50 1.06 1.00 .50 .50 .25 .50 .50 .50 .50 .50 .50 .50 .25 .25 .25 .50 .25 .25 .50 .50 .50 .25 .25 25 Journey Through Jackson I. G. Hood John Henson J. E. Carnes Buford Dillard J. B. Sellers R. H. Bryson John Morris Hute Blanton Early Queen Walter Hoyle Harley Stewman D. H. Stephens Wiley Shepard Dud Parris George Lee Charley Crawford Jack Gunter Clide Gibbs Claton (Unreadable) Bob Williams Bob Phillips Dave Shuler Enes Ash H. H. Ash Floyd Sumner Charlie Hurst Tolley W. B. Morris Jess Brown Lon Cunningham Rosevelt Ensley C. A. Beasley Claud Bryson Charlie Deitz Dewey Blanton Charlie Rhinehart R. C. Middleton Jason Frizzle Harley Stewman Merl Mathison Fred Parris D. K. Gibson Carl Crawford C. D. Waldrop John Morris Mashburn Walter Hoyle Lon Jones Sutton L.P Herman Ashe paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid .25 .25 .50 .50 .50 .30 .25 .50 .50 .50 .25 .25 .50 .50 .50 .50 .50 .25 .25 .50 .50 .25 .25 .25 5.00 .50 1.00 1.00 1.00 .50 .25 .50 .25 .50 .50 .50 .50 .25 .25 .25 .25 .50 .50 .50 .50 .15 1.00 .50 .25 .50 .30 L. P. G Dud Parris H. J. Allman Clyde Fox G. B. Hall G. Goldman Wiley Shepherd D. D. Blanton Sutton Tom Buchanan Harry Ashe Fred ????? ????? L.C. C. ? Stewart R. B. Henson Frank Jones Robert Bishop Buford Ensley E. M. Cagle V. G. Blanton Rand Tolley D. H Monteith C. E. Ashe W. G. Womack C. E. Smith C. L. Smith C. F. Thompson C. F. Thompson J. V. Hoyle W. L. Barnes Roy Jones Luther Deitz C. H. Fullbright Will Norman Sherman Davis. DaveT G. J. Robinson Zell Sutton John Green V. M. Loftis Unreadable Claude Jones E. Allen H. H. Sutton W. D. Warren Lacy L. Bradley Kelly Bradley Y. A. Cook W. C. Beck paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid Winter 2014 .50 .25 .50 .50 .50 .50 .50 .25 .30 .50 .50 .25 .25 .35 .25 .50 .50 .50 1.00 1.00 .25 .50 1.00 .50 .25 .25 1.00 .75 1.00 1.00 1.00 .50 1.00 1.00 .50 1.00 .25 .50 1.00 1.00 .25 .25 .29 .50 .25 .15 .25 .25 1.00 .40 .50 K J '^J K J 26 o c Journey Through Jackson Elmer Hooper Joe Sutton W. A. Franklin George Painter Charlie Morgan J. H. Deitz Z. J. Fincannon Dick Greene G. C. Ward Terrell Clayton Will Fox Roy Buchanan Kenneth Moody D. A. Norman Willie Conley W. W. Ridley Garl Tompson Howard Fullbright Frank Thompson Fred Brown Tom Mitchel Robert Bryson A. C. Swanger Harry Allison paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid •paid paid paid paid paid paid paid .25 .25 .25 1.00 .50 .50 .50 .50 .25 .25 .50 .50 1.00 1.00 .25 .25 .50. .50 .50 1.00 .25 .50 .50 .50 Lonas Green John Green Roll Sutton Paul Ellis E. L. Hooper Carl Vance E. C. Frady Zollie Fincanon A. J. Haskett John Hoyles Cat Smith George Painter Hob Montieth Roscoe Frizzel John Parris Eulah Ashe Quinton Montieth J. L. Montieth J. C. Brown Mack Henry Johnnie Watson Clyde Fox Tom Buchanan paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid paid Winter 2014 .50 .50 1.00 1.00 .50 .25 .25 .50 .50 .50 .50 .50 .25 .25 .25 .25 .25 .25 .55 1.00 .25 1.00 1.00 L i b r a r y A c q u i s i t i o n s L . Call No. F 929.3 929.2 917.58 975.6 929.3 070 975.6 976.8 975.6 070 Author Price, Charles F. Plemmons, Jan (Editor) Plemmons Jan Plemmons, Jan C. Plemmons, Jan C Hall, Joseph S. Nelson, Louise K. West, John F. Title Hiwassee Transylvania Obituaries I'm in the Army Now: World War I Veterans of Transylvania County, NC Foxfire; 4Cfh Anniversary Book Upper Transylvania County, NC, Remembered Index (to) Death Certificates Books 1-20. Transylvania County, NC Smoky Mountain Folks and Their Lore 120 Years of Changes: 1880 - 2000 Tennessee Bible and Family Records The Heritage of Henderson County, NC. Volumes I and II This Proud Land: The Blue Ridge Mountains Donor Ruth C. Shuler Purchase Ruth Shuler Purchase Purchase HughBrank Joe Rhinehart Watauga Association of Genealogists Margaret Payne HughBrank 27 Journeys Through Jackson Winter 2014 T r e a s u r e r ' s R e p o r t f o r 2 0 1 3 KJ Jackson County Genealogical Society Net Cashflow January 1 • December 31,2013 STARTING Balance Book Sales (except HB#1) Heritage Book #1 Arcadia Publishing - Royalty Copier Refund-sales tax Donations (incl royalties) Fund Raiser Interest income Family Memberships Individual Memberships Life Memberships Received for Postage Sales Tax Received Total Regular Deposits STARTING BALANCE + Deposits Expenses Refund of Book Order Dues/Memberships other societies Insurance Library Purchases - Cowan Fund Library Purchases - Other Miscellaneous-copier contract Miscellaneous-Purchases for Resale Miscellaneous-Awards Office Supplies Postoffice Box Rent Postage Prepaid postage Printing/Copying/Reproducing Program Presentation /Meats Rent, Office & Storage Unit Sales Tax Paid Utilities-Telephone Internet: DnetWebsite.Domain Total Expenses Net income Ending Balance Certificates of Deposit Prepaid postage - permit 22 Total Cash Assets Balance in Cowan Library Fund Balance in Scott Foundadtion YTD 14,390.31 3,816.82 3,282.00 34.49 494.65 128.93 494.00 240.00 6.66 1,150.00 2,480.00 1,395.00 114.50 230.75 13,887.80 28,258.11 80.00 140.00 804.00 45.00 234.42 446.84 7,891.36 74.50 470.79 106.00 270.06 590.00 3,507.10 150.00 4,536.00 264.71 76431 * 391.69 20,567.18 (6,699.38) 7,690.93 2,218.90 113.49 10,023.32 31.25 4160.00 K J U 28 Journeys Through Jackson Winter 2014 C C _ • 1 8 8 0 J a c k s o n C o u n t y C e n s u s R e c o r d s ED: We begin in this issue ith the Webster Township. Abstracted in 2013 by Sanji Talley Watson. 1-1 2-2 3-3 4-4 5-5 6-6 Enloe,Wm.A 48 MaryE. 38 Ida J. 19 . SallieT. 17 Laura R. 15 Maggie M. 12 LelaL.8 Scroop W. 6 Florence E. 4 William A. Jr. 3/12 Allison, Andrew B. 23 Sherrill, Edward B.21 Hall, Lucas C. 33 Leatherman, Felix N. 38 Annie C. 30 Lillian L. 7 Florence M. 6 Laura B. 4 Annie C. 3 Ellen E. 5/12 Leatherman, Thomas B. 23 Monday, Martha 19 ??? Allman 33 A. J. Long Jr. 40 Melvina 33 JohnM. 14 Mary J. 11 Emma C. 8 Laura B. 5 Beck, Samuel L. 23. Beck, MollieJ. 20 -Jones, Cora 18 Coward,'TolvinB. 31 RebeccaD. 24 Charles W 5 George O. 3 JohnN. 1 Conner, Henry 17 Johnson, Matt 21 Davis, Silas 53 Susan 52 WadeH. 24 James R. 20 Bryson, Richard 39 SallieJ. 26 W - Retail Merchant W - Wife - Keeping house W - Daughter W - Daughter W - Daughter W -Daughter - At school W - Daughter - At school W - Son - At school W - Daughter W-Son W - Farmer W - Farm Laborer W - Retail Merchant W - Retail Merchant W - Wife - Keeping house W - Daughter - At school W - Daughter - At school W - Daughter - At school , W - Daughter W - Daughter W - Farm Laborer W - House Keeper W - Carpenter W - Register of Deeds W - Wife - Keeping house W - Son - At school W - Daughter - At school W - Daughter - At school W - Daughter W - Nephew - Farm Laborer W - Niece - Assisting in house M - House Keeper W - Retail Merchant W - Wife - Keeping house W-Son W-Son W-Son W - Farm Labor M - Housekeeping M - Farmer M - Wife - Keeping house M - Son - Farmer M - Son - Farmer W - H??????? Maker W - Wife - Keeping house NCNCNC CC cc CC CC CC « CC cc cc cc cc c cc c cc c cc c cc c cc c cc c cc c cc c cc c cc c cc NCNC Wise NCNCTN TNVAVA NCNCTN cc cc cc CC cc cc C( cc cc cc cc cc NCNCNC TNTNTN NCNCNC NCNCNC CC cc cc cc cc cc cc cc cc cc cc cc cc cc c c c c c c c GA GA GA NCNCNC cc cc cc cc cc cc cc cc cc cc cc cc NC NC NC VA NCNCNC cc cc cc cc cc cc NCSCNC NCNCNC 29 Journeys Through Jackson Winter 2014 7-7 8-8 9-9 10-10 11-11 12-12 13-13 14-14 15-15 Tes A. 11 ???? 8 ????E. 6 Maggie B. 2 Andrew V. T. 33 Allen, Nathan 66 Jincy 58 SallieJ. 23 Smith, AicyC. 32 Cora L. 8 Barker, Rufus 23 Watts, Richard 54 Virginia B. 52 Virginia L. 24 Robt. L. 15 Dills, Margaret L. 40 Sarah E. 21 Margaret A. ?? Rhinehart, W. W. 24 Martha T. 19 John R. 1 Burnette, Hue G. 54 Tolly C. 47 Sarah C. 20 Lavisa J. 18 John S. 12 Bryson, Marcus W. 40 MarahE. 32 Stirling T. 13 JermimaR. 11 Jifair S. 6 HuckB. 1/12 Boon, Corstine 22 Stillwell, Croft 29 MarahM. 21 Fisher, J. W. 40 MelliaJ. 29 Hall, Florence S. 13 Price, Jane 19 Hall, David F. 55 Rachel 56 Warren, William 45 Hann 42 IdaL.M. 18 William W. 12 James C. 9 John R. 5 Andrew B. 1 Cabe, Thos. B. 63 W - Daughter W-Son W - Daughter W - Daughter W - Saddler W - Fanner W - Wife - Keeping house W - Daughter W - Daughter W - Granddaughter -at school W - Farm Laborer W - Taylor W - Wife - Keeping house W-Daughter W-Son W - Keeping house W - Daughter W - Daughter W-W- Wife W-Son W - Farmer W - Wife - Keeping house W - Daughter W-Daughter W-Son W-Saddler W - Wife - Keeping house W-Son - At school W - Daughter - At school W-Son W-Son W - Shoe??? W - Retail Merchant W - Wife - Keeping house • W - Farmer W - Wife - Keeping house W - Niece - At school W - Housekeeper W-W-W - Carpenter W - Wife - Keeping house W - Daughter W - Son - Farm Laborer W-Son W-Son W-Son W - Farmer CC C« CC CC U CC CC CC << <c CC tt NC SC NC NCNCNC CC cc cc cc cc cc cc cc cc cc cc cc cc cc cc VAVAVA NC NC NC NCVANC cc cc cc NC NC NC CC cc cc cc cc cc cc cc cc cc cc cc cc cc cc TNVANC NCKYNC NCTNNC cc cc cc cc cc cc NCSCNC NC NC NC cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc NCNCNC cc cc cc NCNCNC NC NC Missouri NCNCNC CC cc cc cc cc cc Missouri NC ? NCNCNC cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc NCNCNC 30 Journeys Through Jackson Winter 2014 < w _ - ^ 16-16 17-17 18-18 19-19 20-20 21-21 22-22 23-23 Catherine 60 Joseph H. Wilson, Vilet 18 Hall, Andrew M. 22 MoriahW. 17 Bradley .William J. 35 Jamima 64 MandaJ. 13 Scinthy E. 11 Jamison 8 Bradley, Harrison 31 LarraA. 21 Caldonia 3 Lorancy D. 2 MandaA. ?/12 Bradley, John 27 Cagle, Evan 46 Margaret L. 41 Allen B. 18 JohnW. 15 Cordelia D. Y3 Candas E. 8 Wm.C. 6 Candler C. 4 Jehu C. 4 Barker, Jamison 66 Catherine 70 Charity E. 36 Jehu F. 21 Hester M. 10 Barker, John 51 Morah M. 38 Lissa C. 14 Thos. L. 13 David E. 11 John E. 9 Lizza C. 7 Mariah Z. 5 Elizabeth R. 2 McMahan, Ray A. 52 Emly L. 48 Thos.C 18 John S. 16 Robt. P. 14 LeviW. 11 Cora E. 6 Cunningham, M. S. 32 W - Wife - Keeping house W - Son - Farm Laborer W - Housekeeping W - Farmer W — Wife - Keeping house W - Farmer W - Keeping house W - Niece - Assisting keeping house W - Niece W - Niece W - Farmer W - Wife - Keeping house W - Daughter W - Daughter W - Daugher W - Farm Laborer W - Farmer W - Wife - Keeping house W - Son - Farm Laborer W - Son - Farm Laborer W - Daughter - Assisting keeping house W - Daughter W-Son W - S o n W - S o n W - Farmer W - Keeping House W - At Home W - Grandson Farm Laborer W - Granddaughter W - Farmer W - Wife Keeping House W-Daughter Keeping House W - Son Farm Laborer W - Son Farm Laborer W - S o n W - Daughter W - Daughter W - ?Daughter W - Farmer W-Wife Keeping House W - Son Farm Laborer W - Son Farm Laborer W - Son Farm Laborer W - Son Farm Laborer W - Daughter W - Farmer VANCNC NCNCNC CC cc cc NCNCNC cc cc cc NCNCNC NCALAL NCNCNC CC cc cc cc cc cc NCNCNC CC CC CC cc cc cc cc cc cc cc cc cc NC NC NC cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc. cc cc cc NCNCNC NC SC SC NCNCNC cc cc cc cc cc cc NCNCNC cc cc cc cc cc cc cc cc cc cc tt, cc cc cc cc cc cc cc cc cc cc cc cc cc NCNCNC cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc NCNCNC 31 Journeys Through Jackson Winter 2014 24-24 25-25 26-26 27-27 28-28 29-29 30-30 31-31 32-32 33-33 Cling M? 11 Caldora 8 Bradley, Lucinda 33 EliC. 18 Delfina 8 Baxter C. 3 McMahan, T? 52 Sinthy 51 Riley 20 Levi M. 17 JohnM. 14 Sinthy C. 11 Alis 8 McMahan, Wm. S. 24 Clearcy E. 23 Ellend A. 3 Samuel G. 3/12 McMahan, John 58 Tildia 24 Margaret J. 18 SofA. 16 Levi 12 Cordela 9 David 7 Dills, Cisero L. 21 Rachel M. 21 Gribble, Rufus 17 Queen, Tho. B. 22 Sallie J. 26 Sutton, Henry 45 Elizabeth 47 Delphia 26 James 13 Dills, Jasper A. 24 Queen, William H. 33 Sarah A. 22 Coleman S. 8/12 Cunningham, C. 25 Samantha E. 22 Cora E. 4 Allis C. 7/12 Sutton, Wm. J. 25 Sallie A. 21 1/19 W-Son Farm Laborer W - Daughter W - Keeping House W - Son Farm Laborer W - Daughter W-Son W - Farmer W - Wife Keeping House W —Son Farm Laborer W-Son Farm Laborer W-Son Farm Laborer W - Daughter Assisting keeping house W - Daughter W - Farm Laborer W-Wife Keeping House W - Daughter W-Son W-Farmer W - Daughter Keeping House W-Daughter Housework W-Daughter Housework W - Son Farm Laborer W - Daughter W-Son W - Farmer W-Wife Keeping House W - Farm Laborer W - Farm Laborer W-Wife Keeping House W — Farmer W - Wife Keeping House W - Assisting Housekeeping W - Farm Laborer W - Farm Laborer W - Farmer W-Wife Keeping House W - S o n W - Farm Laborer W-Wife Keeping House W-Daughter W - Daughter W - Farmer W-Wife Keeping House W-Son CC cc cc cc cc cc NCNCNC NCTNNC NCNCNC CC cc cc NCNCNC TNTNTN NCNCTN CC cc cc cc cc cc cc cc cc cc cc cc NCNCTN NCNCNC cc cc cc cc cc cc NCNCNC cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc NCNCGA NCNCNC cc cc cc NCNCNC cc cc cc NCNCNC cc cc cc cc cc cc cc cc cc NCNCNC NC NC MO NC NC NC cc cc cc NC NC NC cc cc cc cc cc cc cc cc cc NC NC NC cc cc cc cc cc cc \ J 32 Journeys Tlirough Jackson Winter 2014 ^ R u t h B r y s o n M y s t e r i e s These pictures were brought to the Society by member Ruth Ensley Bryson. She does not know the identity of any of the people in the photographs. If you know who any of these people are, please let the Society or Ruth know. < ^ _ • 33 Journeys Through Jackson Winter 2014 '^J ^J K J 34 Journeys Through Jackson Winter 2014 _ • ^ * w 35 Journeys Tlirough Jackson Winter 2014 \ J Kj K J 36 Journeys Tlirough Jackson Winter 2014 C _ • C 1 9 3 1 J a c k s o n C o u n t y D e a t h C e r t i f i c a t e s o f P e r s o n s B o r n 1 9 0 0 - 1 9 31 [Key to reading the following: Name of deceased; Date of birth; Place of birth; 1931 date of death; Father's name; Father's place of birth; Mother's name; Mother's place of birth; Informant's name; Informant's address; Cemetery. Abstracted by Sanji Talley Watson in the Jackson County Register of Deeds Office 2013.] Barker's Creek Green, Annie Belle; 18 Dec 1930; NC; 20 Jan; Willas Green; NC; Delsie Mashburn; NC; Clifton Ward; Whittier; ng Wikei; Robert; 1 Jul 1929; Barker's Creek; 17 Dec; Pierce Wikel; NC; Martha Hensley; NC; Jason Wikel; Whittier; Barker's Creek Wikel, Robert; 1 Jul 1929; NC; 17 Dec; Pierce Wikel; NC; Martha Hensley; TN; Frank Gunter; Whittier, Moody (This was a second death certificate for this person) Canada Massingale, Irene; 15 Mar 1931; ng; 18 Mar; Whitney Massingale; Jackson Co.; Mary Broom; Jackson Co.; Whitney Massingale; Argura; Massingale Shook, Dick; 2 Mar 1928; Jackson Co.; 2 Mar; J. L. Shook; ng; Lizzie Galloway; ng; J. L. Shook; Wolf Mountain; ng Reese Charlie; 20 May 1931; Argura; 20 May; Wess Reese; NC; Levia Alexander; NC; Frank Crawford; Argura; Sols Creek Roper, Fred K.; 23 Jun 1931; Jackson Co.; 23 Jun; Carl Roper; Cowee township, Macon Co.; Ethel Smith; Buringtown, Macon Co.; Coot Harris; Argura; Harris Roper, Rinnie Mae; 23 Jun 1931; Jackson Co.; 23 Jun; Carl Roper; Cowee township, Macon Co.; Ethel Smith; Buringtown, Macon Co.; Coot Harris; Argura; Harris Caney Fork Broom, Glaydas; 1 y, 9 m, 24 d; ng; 11 Feb; Kermit Henry Broom; Cowarts; Eva Queen; Cowarts; ng; ng; Queen Mills, Alvin Clifford; 2 y, 6 m; Cowarts; 13 Feb; Lucious Mills; Cowarts; Bessie Hoxit; Cullowhee; ng; ng; Hooper Watson, Lynda Mae; 19 Mar 1931; ng; 19 Mar; Isac Watson; Hazelwood, Haywood Co.; Maud Rice; Spartanburg, SC; ng; ng; Balsam Grove Hooper, Alma June; 3 m, 11 d; ng; 4 Jul; Vergie Hooper; Cowarts; Delia Blackburn; Macon Co.; ng; ng; Brasstown Aiken, Annita; 24 Dec 1931; Rich Mountain; 24 Dec; Cicero Aiken; Rich Mountain; Ada Watson; Rich Mountain; ng; ng; Balsam Grove Galloway, Delores; 7 Feb 1929; Cowarts; 18 Nov; Horace Galloway; Transylvania Co.; Mae Galloway; East La Porte; Mae Galloway; ng; East La Porte Cashiers Allen, Franklin D.; 4 m; Cashiers; 11 Mar; Frank Allen; Salem, SC; Margery Bumgarner; Cashiers; ng; ng; Cashiers Hooper, Willie Ray; 3 m; Cashiers; 20 Jun; Henry Thomas Hooper; TN; Dora Elizabeth Hooper; Swain Co.; Henry Hooper; Cashiers; Cashiers 37 Journeys Tltrough Jackson Winter 2014 Baumgarner, Paul Haywood; 29 y, 3 m; Transylvania Co.; 13 Dec; Elbert W. Baumgarner; Cullowhee; Octa I. Shelton; Tuckasegee; Mrs. E. W. Baumgarner; Cashiers; Cashiers Cullowhee \^> Williams, Katy; 18 Jan 1931; Speedwell; 18 Jan; Lewis Williams; Elijay; Estella Wood; Cullasaga; Lewis Williams; Speedwell; Speedwell Coward, Oscar; 3 Jul 1901; NC; 25 Jan; George Coward; NC; Rosa Shook; NC; Mary Shelton; Cullowhee; Cullowhee Cotter, James Robert; 28 Jun 1922; Cullowhee; 29 Jun; Robert Cotter; Morristown, TN; Hazel Hawkins; Waynesville, NC; Mrs. Ida Cotter; Cullowhee; Cullowhee Lackey, David Jr.; 15 Mar 1931; Cullowhee; 7 Mar; David Lackey, Sr; Cullowhee; Francis E. Love; Dillsboro; Onell Lackey; Cullowhee; Cullowhee Bumgarner, Flora A.; w/o Vernon; 24 Dec 1904; Jackson Co.; 9 Apr; Frank Conner; Buncombe Co., NC; Caroline Cope; Jackson Co.; Vernon Bumgarner; Speedwell; Bumgarner Young, Infant Girl; 8 May 1931; Speedwell; 8 May; Jack Young; Macon Co.; Fannie Bennett; Speedwell; Mrs. G. A. Tilley; Speedwell; Fox Pressley, Sallie A.; w/o Earl; 9 Sep 1907; Speedwell; 26 May; Robt. D. Pressley; Speedwell; Ivy Lee Ashe; Speedwell; Earl Pressley; Speedwell; Hooper Nicholson, Delsis Pearl; w/o Robt.; 29 y, 2 m, 26 d; Cullowhee; 15 Jun; Lewis Oxner; Waynesville, NC; Rebecca Watson; Cullowhee; Henry Oxner; ng; Cullowhee Hurt, Infant Boy; 11 Sep 1931; Cullowhee; 11 Sep; Cleveland Henry Hurt; Luray, VA; Bonnie Ethel Ray; White Rock, NC; "Mother"; Cullowhee; Cullowhee Frady, Sara Lou; 22 May 1909; Webster; 16 Oct; Talley Pinon; Savannah; Laura Buchanan; Savannah; Talley Pinon; Cullowhee; Stillwell Frady, Bessie Helen; 31 Oct 1931; Cullowhee; 31 Oct; Edgar Frady; NC; Annie Mae Martin; FL; Edgar \^^) Frady; Cullowhee; Cullowhee Dillsboro Jones, Enos Hillard; 1 Jan 1906; Jackson Co.; 31 Jan; Fidelia Jones; NC; Pearl Messer: NC; Sallie Jones; Dillsboro; Parris Brooks, Ernest Sylvester; 30 Mar 1930; Jackson Co.; 3 Dec; Arthur Brooks; NC; Laura Jenkins; NC; Arthur Brooks; ng; Locust Field Maney, Callie; 1908; Swain Co.; 1 Oct; M. L. Maney; GA; Bell Snyder; NC; Jesse Maney; ng; Smokemont Green's Creek Allison, Marion Jane; 7 Jan 1931; Green's Creek; 23 Jul; Bragg Allison; Green's Creek; Maggie McGinnis; NC; Clinton Sutton; Green's Creek; Green's Creek Green, Betty; 25 Jul 1931; Green's Creek; 25 Jul; Lenoir Green; Green's Creek; Nellie Trantham; Green's Creek; Estes Trantham; Green's Creek; Green's Creek Thompson, Lillian; 17 Aug 1931; Green's Creek; 17 Aug; J. B. Thompson; NC; Otelia Norman; NC; Jason Morgan; Green's Creek; Old Savannah Hamburg Moore, Mary Glaydas; 15 May 1931; NC; 15 May; Jasper Moore; NC; ? Broom; NC; Catherine Davis; Big Ridge; Big Ridge ^j 38 Journeys Through Jackson Winter 2014 . Stewart, James Eldon; 9 m, 16 d; Norton; 4 Jun; J. Lyman Stewart; NC; Winnie Bumgarner; NC; J. \^/ Lyman Stewart; Norton; Norton Thomas, Howard James; 7 m, 6 d; Alabama; 3 Jul; Henry Thomas; Michigan; Haysel Bryson; NC; J. R. Bryson; rjg; Glenville Mathis, Bertie Mae; 14 May 1931; Erastus; 14 May; ng; ng; Oma Mathis; Erastus; ng; ng; Double Springs Mountain Watson, Garlin; 16 y; NC; 19 Jun; Wilburn Watson; NC; Delia Young; ng; ng; Shook Moses, Bettie Lou; 1 y, 3 m; Tuckasegee; 8 Aug; Bert Moses; N; Bertie Stewart; Erastus; ng; ng; Tuckasegee Qualla Bradley, Laura Mae; 2 y, 7 m, 1 d; Wilmot; 20 Jan; Fred Bradley; Wilmot; Hester Mashburn; Franklin, NC^Fred Bradley; Wilmot; ng Bradley, Lewis; 21 Dec 1930; Jackson Co.; 25 Jan; Carry Bradley; NC; Mamie Sutton; NC; ng; ng; ng Sutton, James M.; 16 y, 4 m, 14 d; NC; 14 Oct; Andy Sutton; NC; Caroline Green; NC; Mrs. Maggie Spiriler; East Graham, NC; Savannah Reagen, Bobby; 15 Nov 1931; Whittier; 15 Nov; Ross Reagen; NC; Lorena Bradley; NC; Hanson Bradley; Whittier; Campground River L • Golden, J. H.; 23 Jul 1931; Tuckasegee; 18 Aug; James Golden; Tuckasegee; Wanna Mathis; ^ * / Tuckasegee; Will Golden; Tuckasegee; Shook Middleton, Ivie; 29 Sep 1909; Tuckasegee; 8 Oct; John Luther Middleton; Tuckasegee; Eva Watson; NC; James Brown; Tuckasegee; Middleton Jones, Cecil; 11 Mar 1912; Johnson City, TN; 11 Nov; Leroy Jones; Flagpond, TN; Flora Bamet; Mitchell Co., NC; Preston Jones; East La Porte; East L Porte (This certificate has Macon County on it and it is crossed out and River written on it.) Jones, Roy; 8 Jul 1931; NC; 7 Oct; J. F. Jones; NC; Minnie Mathis; NC; J. F. Jones; Tuckasegee; ng (Woodring) Savannah Buchanan Mara Efter; 25 y; East Fork; 10 Mar; Will Buchanan; East Fork; Etter Stiles; Gay; Clarence Beck; Green's Creek; East Fork Cabe, James Porter; 9 y; Gay; 30 Mar; James Cabe; Gay; Lillie Deitz; East Fork; V. C. Buchanan; Gay; East Fork Webb, Rena Hampton; 3 y; Gay; 20 Mar; Birt Webb; Mamie Trantham; Gay; Alex Passmore; Gay; Zion Hill Deitz, Otis Cowan; 1 d; East Fork; 15 Apr; Hoyle Otis Deitz; East Fork Inez Elizabeth Herring; GA; Hoyle Deitz; ng; East Fork Cabe, Naomia Emery; 6 y, 3 m, 12 d; Green's Creek; 18 Dec; J. W. Cabe; Green's Creek; L. S. Cabe Deitz; Green's Creek; T. S. Deitz; Green's Creek; East Fork ^ Scotts Creek Ash, Grady; 15 d; NC; 27 Jan; Horace Ash; NC; Etta Ammons; NC; Horace Ash; ng; Willets 39 K J Journeys Through Jackson Winter 2014 Bryson, Avalina McCall; 1 m, 2 d; NC; 15 Jan; Fred Bryson; NC; Allie McCall; NC; Fred Bryson; Balsam; Balsam Jones, Winnona; 10 d; NC; 29 Jun; John Jones; NC; Lola Smathers; NC; John Jones; ng; Balsam Smathers, Hary Arthur; 4 m, 2 d; NC; 27 Jan; Ruffus Smathers; NC; Inez Derrick; NC; Ruffus Smathers; Balsam; Balsam Mathis, Flora; 1 m, 15 d; NC; 1 May; John B. Mathis; NC; Annie McGaha; NC; John B. Mathis; Sylva; Addie Jones, Hary Arthur; 8 m, 28 d; Willets; 28 May; Roy Jones; NC; Suannie Mills; NC; Roy Jones; Willets; Addie Sylva Wilkes, (No name listed); 19 May 1906; Sylva; 7 Jan; J. R. Wilkes; Jackson Co.; Bushie Cunningham; Jackson Co.; J. R. Wilkes; Sylva; Beta Massie, Infant Boy; 17 Aug 1931; Sylva; 17 Aug; Elvin Massie; ng; Adna Wheeler; ng; Elvin Massie; Sylva; ng Austin, Sarah Elizabeth; 30 Jul 1931; Sylva; 7 Sep; ng; ng; Louise Austin; Sylva; Louise Austin; Sylva; Parris Dillard, Clyde McCully; 1 Jan 1931; Sylva; 24 Jun; Ralph Dillard; Sylva; Eva Beasley; Franklin; Ralph Dillard; Sylva; Sylva Cotter, Mrs. Maud; w/o Clain; 9 Jul 1902; Bryson City; 13 Apr; T. M. Goodson; Waynesville; ? Goodson; Bryson City; T. M. Goodson; Bryson City; Brown Cotter, Infant Boy; 7 Apr 1931; Sylva; 8 Apr; David Clain Cotter; Cullowhee; Maud Goodson; Bryson City; Clain Cotter; Cullowhee; Rogers Bishop, James Ray; 2 May 1931; Sylva; 2 May; James Monroe Bishop; Ark; Minni P. Calhoun; NC; Mrs. Jas. Monroe Bishop; Bryson City; Bryson City 'i) Mathis, Dewey Edgar; 6 Feb 1915; Argura; 24 Jun; R. H. Mathis; Argura; Rachel Phillips; Argura; R. H. Mathis; Argura; Sols Creek Buchanan, Pearlie Patie; w/o William A.; 1 May 1905; Haywood Co.; 19 Jun; Obediah Brown; Cooke Co., TN; Annie McGaha; Cooke Co., TN; Obediah Brown; Sylva; Beta Miller, Mattie Fore; w/o Rass; 22 Jun 1907; Macon Co.; 28 Jul; J. Whit Fore; Transylvania Co.; Eva Gibson; Hayesville; J. Whit Fore; Gastonia, NC; ng Monteith, Billie Clifton; 19 Apr 1931; Spruce Pine; 5 Jul; Willie Monteith; Dillsboro; Susie Brown; Cullowhee; Willie Monteith; ng; Sylva Fugate, Lola; w/o Wayne; ng; Cashiers; 10 Aug; Frank Bumgarner; Jackson Co,; Malinda Bumgarner Cashiers; Frank Bumgarner; Cashiers; Cashiers Dean, Joseph Pete; 14 Jul 1931; Sylva; 15 Aug; Charlie Dean; Sylva; Irene Cloer; Sylva; Charlie Dean; Sylva; Wesley's Chapel Bryson, George Hayes; 31 y, Glenville; 9 Oct; John B. Bryson; Glenville; Myra Buchanan; Cullowhee; Dewey Bryson; Glenville; Glenville Howell, Burke; 31 y; Webster; 5 Dec; Lee Howell; Webster; Laura Dorsey; Webster; Lee Howell; ng; Revis Jones, Julius; 23 y; NC; 10 Dec; D. D. Jones; NC; Jane Sitton; NC; ng; ng; ng Webster Rhinehart, James Bowman; 4 Mar 1931; Webster; Frank T. Rhinehart; NC; Leona Mull; Waynesville; Frank T. Rhinehart; Webster; Webster Baker, Infant Girl; 31 May 1931; Webster; 31 May; Hershel Baker; Dillsboro; Ethel Vance; Pinolo, NC; Mrs. Hershel Baker; Webster; Webster 40 L * < ^ ^ Journeys Tlirough Jackson Winter 2014 B o o k R e v i e w : Green River Graves - Hooper and Related Families JCGS member Stanley Hooper drove up from Rutherford County on Monday December 16 to present his new book to the Society. Subtitled 250 Years of Hooper Heritage, Stanley mentions in his introduction that "this book may include contradictions." He first goes into detail with the children of Absalom Hooper, then moves into his own line with James Hooper, son of Absalom, eventually moving to Henry Floyd Hooper, then to the present generations. The book is filled with photographs which were inadequately reproduced by the publishers and printers. But with that said, the book also contains engaging reminiscences such as "Shared Memories of Garland Hooper" and copies of old letters (copied verbatim) from family members. Features such as these make for very interesting reading and serve to honor the memories of family members. For Stanley Hooper's father, Delas Hooper, each of twelve children is spotlighted with biographical information, pictures, and, again, a "shared memories" section. After a short section on each of his five sons, Stanley includes a time line about the Hooper and Mills families, and concludes the book with a section of photographs which have not been identified. Anyone who does genealogy loves a good mystery photograph, and some of these are very fine. Persons who are looking for evidentiary proof about Hooper ancestors might not be pleased with Stanley's format He does not pretend to have all of the answers, and he is very honest about this, always a refreshing trait in genealogy. But after all, most of us are not professional genealogists, and again, most of us love to read personal remembrances and look at old pictures. For these reasons, Stanley has added a valuable book on one branch of the huge Hooper family, and we trust that his stated purpose of inspiring the future generations will come to fruition. JCGS does not have this book to sell because of the nature of Stanley's contract with his publisher. Persons who are interested may find information on the Internet by using the book's title at Iulu.com. Larry Crawford 41 Journeys Through Jackson Winter 2014 2 0 1 4 J C G S M e e t i n g S c h e d u le KJ JCGS has it's monthly meetings on the second Thursday of each month. The schedule for the meetings for 2014 is below. Come out and join us for any or all of the meetings. They are always open to the public, so spread the word to people you think might be interested in any of these fine programs. As always, the dates for the programs will stay the same, the speakers and topics are subject to change. Check our website or call the office with any questions or for conformation of the program. If you have any ideas regarding the programs to be offered, contact Timothy Osment or Bill Crawford. January 9 The History of Smokemont and the Luftee Baptist Church with Dick Sellers February 13 Mountain Music With Jesse & Friends March 13 The Plott Family, the Plott Hound, and the Plott Balsams With Bob Plott April 10 The Dentist, James Madison Zachary of Norton, and his 8 Daughters With Jane G. Nardy May 8 The 17 Jackson County National Register Properties (and their stories) With Joe Rhinehart June 12 "In Recognition of the 70th Anniversary of D-Day, Jackson County Memories of WWH" With Teresa Deitz Manring July 10 Old Tools, Instruments, Knives and Implements With James Monteith, Bill Crawford, Jason Gregory, R. O. Wilson and Rick Frizzell ^J August 14 Dillsboro's Monteith Cove With The Appalachian Women's Museum September 11 Glenville, Community History, & The Families With Carol Bryson October 9 Fall Fundraiser Event November 13 TBD December 11 Annual Christmas Dinner ^J 42 Journeys Through Jackson Winter 2014 ( W W o r l d W a r I D r a f t C a r d s F o r J a c k s o n C o u n t y , N o r t h C a r o l i na ED: These are abstracts from World War I draft cards for men living in Jackson County in the years 1917-1918. To read: Name; Birth date; Race; Birthplace; Which Draft Card was used. The listing of registration place for the majority of the men is simply "Jackson, NC." Abstracted by Sanji T Watson 2013. o ^ Adams, Andy Adams, Daniel Harrison Adams, Leon Banister Adams, William Alen Adams, Wm Crawford Aiken, Augustas Aiken, John Aiken, Johnie Aiken, Perry Roland Akin, Cicero Loftis Akin, Eular Akin, Theodore Alexander, Bowen Alexander, Doctor Vernon Alexander, John Wesley Alexander, Judson Alexander, Warren S. Alexander, Will Alison, Charlie Andrew Allen, Arthur Alexander Allen, John Allen, John Allen, Lawrence Allen, Marion G. Allen, Sherman Allen, Thad Allen, William Orsborne Allen, Wolff Lenoira Alley, Felix Morris Alley, John Hayward Alley, Louis Douglas Alley, Mack Hooper Allison, Bragg Thomas Allison, Chas. Layfatte Allison, Coleman Birch Allison, John Claude Allison, John Danle Allison, Roy Cleveland Allison, Willie Cary Allison, William Logan Allman, Frank 14 May 1893 15 Feb 1879 1 Oct 1899 10 Feb 1879 16 Aug 1896 1879 5 Apr 1891 5 Feb 1900 1 Sep 1883 12 Mar 1884 8 Feb 1894 1896 23 Nov 1891 10 Mar 1895 1896 1881 5 Jul 1885 14 Jan 1891 6 Jun 1885 13 Mar 1880 8 Oct 189 (sic) 26 Mar 1886 13 Jul 1882 17 Aug 1889 3 Jun 1888 12 Oct 1881 18 Sep 1885 27 May 1895 26 Mar 1893 7 Apr 18 (sic) 20 May 1894 5 Jun 1899 27 Jul 1884 18 Apr 1880 19 Nov 1896 6 Mar 1887 17 Oct 1876 30 Oct 188 (sic 21 Feb 1873 14 Oct 1880 25 Jul 189(sic) W W W W W W W W W W W W W W W W W W W W B W B W B B W W W W W W W W ng W W ;)W W W W Speedwell, NC ng ng Speedwell, NC Cullowhee, NC ng Sylva, NC ng ng ng NC, USA NC, USA Oconee Co.,SC Salem, SC Argura, NC ng ng Tuckasegee, NC ng ng Webster, NC NC, USA ng Barnwell, SC Webster, NC ng ng Sylva, NC Speedwell, NC Mulberry, FL Bustow, FL ng ng ng Greens Creek, NC Barkers Creek, NC ng ng ng ng Webster, NC A C C A B C A C C C A A A A A C C A C C A A C A A C C A A A A C C C B A C C C C A 43 Journeys Through Jackson Allman, James Arthur Allman, John Coleman Allman, John Herbert Allman, Walter Harrison Ammons, Dewey Harrison Ammons, George Harve Ammons, Richard Pierson Ammons, Tom W. Ammons, Wesley Lawn Angel, Carl Logan Anthony, William Westley Arch, Noah Arneach, Jefferson Armachain, Lacy Arnold, John Washington Arrington, Bedford Arrington, Lenore Bruce Arrington, Tom Berlin Arwood, Samuel David Ash, Jasper Hamilton Ashe, Alex (Elisha) Ashe, Charlie Ashe, Charlie Hampton Ashe, Dexter Ashe, Ennis Wilson Ashe, Erwin Fred Ashe, Felix Monroe Ashe, Flem Ashe, Franklin Shireley Ashe, Fred Ashe, Garland Ashe, George Walter Ashe, Henry Hedle Ashe, Homer Clyde Ashe, James Ashe, James Ashe, James Elijah Ashe, James Robert Ashe, John Emanuel Ashe, John Lewis Ashe, John Mack Ashe, Lewis Houston Ashe, Lon Ashe, Luster Ashe, Luther Hillard Ashe, Manuel Lee Ashe, Napoleon Bonaparte Ashe, Ralph Ashe, Raymond Theodore Ashe, Roy Robert Ashe, Sherlie 17 Mar 1884 W 20Sepl87(sic)W 10 Jul 1898 21 Dec 1888 7 Nov 1898 25 Dec 1880 14 Feb 1895 22 Jan 1878 W W W W W W 27Aprl90(sic)W 4 Jul 1889 19 May 1876 28 Feb 1892 7 Apr 1874 5 Oct 1877 3 May 1878 24 Jul 1878 7 Oct 1899 15 Dec 1899 5 May 1891 Feb 1894 2 Sep 1898 25 Jul 189(sic; 25 Dec 1897 Oct 1896 3 Jun 1893 W W I I I B W W W W W W ) NG W NG W 13Decl89(sic)W 6 Nov 1875 ng 29 Aug 1899 10 Sep 1899 9 Dec 1890 22 May 1899 6 Jan 1899 9 Dec 1900 2 Aug 1897 3 Feb 1893 2 Sep 1898 30 Apr 1886 16 Apr 188(sic 7 Jun 1895 13 Oct 1891 27 Jun 1889 3 Oct 1894 8 Mar 1890 25 Mar 1900 18 Feb 1898 12 May 1877 1 Dec 1899 W W W W W W W W NG W W W :)W W W W W W W W W W 15Marl89(sic)W 29 Jul 1896 19 Apr 1895 NG W ng ng ng Webster, NC ng ng NC, USA ng ng Frankiln, NC ng Cherokee, NC ng ng ng Cowarts, NC Addie, NC ng Titus, GA NC, USA ng Jackson Co ng Tuckasegee, NC Sylva, NC Dillsboro, NC ng Jackson Co. ng ng Cullowhee, NC ng ng ng Greens Creek, NC Speedwell, NC ng ng Webster, NC GA, USA Sylva, NC Wilmot, NC Tuckasegee, NC NC ng ng ng ng Webster. NC Webster, NC Tuckasegee, NC Winter 2014 C C C A C C A C c A c A C C C A A C A A C B C B A A C A C C A C C C B A C C A A A A A A C C C C A B A K J v J KJ 44 < w Journeys Through Jackson Ashe, Thomas Ashe, Thomas Sylvanas Ashe, Thomas Walter Ashe, Wade Ashe, "William Donaldson Ashe, William Elcie Ashe, William Estus Ashe, William Jesse Ashe, William Tecumeck Ashe, William Walter Austin, Charley Austin, Ed Lee 21 Jan 1895 8 Aug 1875 1 Jan 1895 21 Dec 1897 14 Jan 1891 3 Mar 1893 6 Jun 1897 Aug 1897 W W W W W W W W 28Mayl8(sic) W 27 Mar 19(sic 22 Feb 1891 ) W W 12Sepl87(sic)W Jackson Co. ng Tuckasegee, NC ng Webster, NC Sylva, NC ng Webster, NC ng Marion, NC ng Winter 2014 A C A C A A C B A C A C Below are examples of the information obtained on the different draft cards. Card A _ • U 45 Journeys Tlirough Jackson Winter 2014 CardB ^J K J CardC ^ y 46 Journeys Tltrough Jackson Winter 2014 ^ I n d e x c c Adams 43 Aiken 37,43 Aiken 43 Akins25 Alexander 37, 43 Alison 43 Allen 1,26, 30,37,43,45 Alley 11,43 Allison 11, 12, 17, 18,27,29, 38,43, 46 Allman 26, 29,43,44 Ammons 39,44 Anderson 12 Andrew 30 Angel 44 Anthony 44 Arch 44 Armachain 44 Arneach 44 Arnold 44 Arrington 44 Arwood 44 Ash 26, 39,44 Ashe 4, 11, 12, 15,25,26, 27, 38,44,45 Aulicino 19 Austin 40,45 Baker 40 Ballard 21,22 Bamet 39 Barker 15,16,30,31 Barnes 12,25, 26 Barns 25 Beasley 26,40 Beck 27,29. 39 Bennett 38 Bishop 1,26,40 Blackburn 37 Blanton 1, 25, 26 Boon 30 Boyd 18 Bradley 26,31, 39 Bramlett 25 Brank 27 Brooks 12,38 Broom 37, 38 Brown 8, 25,26,27,39, 40 Broyles 11 Bryant 1, 25 Bryson 11,12,16, 18,25,26, 27, 29, 30,33, 39,40,42 Buchanan 11, 12,15 18,25, 26, 27, 39,40 Bumgarner 11, 12, 15, 17,25, 37,38, 39,40 Burnette 30 C a b e l l , 12,18,25,30,39 Cagle 12, 25, 26,31 Calhoun 40 Carnes 12, 26 Carpenter 12 Cathey 4, 5 Clayton 27 Clement 25 Cloer 40 Cobbl Conley 27 Conner 25, 29, 38 Cook 1, 26 Cope 12, 25, 38 Cotter 38,40 Cowan 8, 11, 12,26,46 Coward 11,12,29,38 Craig 22 Crawford 1,26,37,41,42 Cunningham 12,25,26,31, 32,40 Davis 2, 11, 12, 16, 17,26, 29,38 Dean 40 Deitz 1,12,25,26,27,39,42 Derrick 40 Dillard 25,26,40 Dills 1, 13, 30, 32 Dorsey 40 Ellis 21,27 Enloel8,29 Ensley 25,26,33 Evans 11,13.25 Fincannon 27 Fisher 30 Fore 40 Fox 25, 26,27 Frady 27, 38 Francis 16 Franklin 25, 27 Frizell 9, 11 Frizzel 27 Frizzell 25, 42,46 Fugate 40 Fullbrightl 1,13,26 Galloway 6, 37 Gates 2 Gibbs 26 Gibson 26, 40 Golden 39 Goldman 26 Goodson 40 Green 2, 15,26,27,37,38, 39 Greene 27 Gregory 42 Gribble 13, 32 Gunter 2, 26 Hall 13, 15,26,27,29,30,31 Harrill 25 Harris 13, 25,37 Haskett 27 Hawkins 38 Hayes 1 Henderson 5 Henry 27 Hensley 37 Henson 11,13,25,26 Herring 39 Higdon 11,16 Hines 7 Hood 26 Hooper 1,27,37,41 Howell 40 Hoxit 37 Hoyle 26 Hoyles 27 Hurst 25, 26 Hurt 38 Jackson 13 James 25 Jamison 16 Jenkins 13,38 Johnson 22, 29 Jones 8, 9, 13, 18,25,26,29, 38,39,40 Keener 16, 17 Kilpatrick 25 47 Journeys Through Jackson Winter 2014 Lackey 38 Leach 16 Leatherman 29 Ledford 13 Lee 26 Lewis 13,25 Loftis 26 Lomanac 25 Long 13, 29 Love 18,38 Luker 6 Madison 9,11, 13 Mallonee 13 Maney 38 Manring42 Martin 38 Mashburn 26, 37, 39 Mason 1 Massie 40 Massingale 37 Mathews 1 Mathis 4, 5, 13,39,40 Mathison 26 McCall 1,4, 5, 6,40 McConnell 11, 13 McCracken 25 McGaha 40 McGinnis 1, 38 McMahan 31,32 Messer 38 Middleton 25, 26, 39 Miller 40 Mills 37, 40,41 Mitchel 27 Monday 29 Monteith 26,40, 42 Montieth 27 Moody 27, 37 Moore 8, 11,13,38 Morgan 13,27,38 Morris 25,26,4 Morton 1 Moses 39 Mossl, 13,45 Mull 40 Munday 18 Nardy 42 Nelson 27 Nicholson 25 Norman 25, 26, 27, 28 Osmett 42 Owen 2, 4, 5, 6 Painter 11, 13,25, 27 Parker 13 Parris 25,26, 27 Passmore 16, 39 Patterson 25 Payne 27 Phillips 2, 16, 17,25,26,40 Pilky 18 Pininon 13 Plemmons 27 Plott 42 Pressley 38 Price 27, 30 Proffitt 13 Queen 1,26, 32, 37 Quilliams 15 Raby 7 Ray 38 Reagen 39 Reese 37 Rhinehart 11, 26,27, 30,40, 42 Rice 37 Ridley 27 Robinson 25, 26 Rogers 13, 18 Roper 37 Rowland 7 Ruskin 23 Scott 1, 2 Self 11 Sellers 26, 42 Shelton 2, 38 Shepard 26 Shepherd 26 Sherrill 13,29 Shook 6,37,38 Shuler 25,26, 27 Sims 15,25 Sitton 40 Smathers 40 Smith 13,15,25,26,27,30, 37 Snyder 38 Spiriler 39 Stanford 25 Stephens 26 Stewart 25,26, 39 Stewman 26 Stiles 13, 14, 39 Stillwell 9,11,14,30 Strain 17 Suddreth 2 Sumner 25,26 Sutton 26,27, 32, 38, 39 Swanger 27 Talie 25 Talley 37 Tatham 14, 15, 16,17, 18 Thomas 39 Thompson 14,26,27,38 Tilley 38 Tolley 26 Tompson 27 Trantham 38, 39 Vance 25, 27, 40 Waldroop 14 Waldrop 26 Walker 8, 25 Ward 27,37 Warren 26,30 Watson 14,21, 22,27, 37, 39 Watts 30 Webb 15, 39 Welch 15 West 27 Wheeler 40 Wikel 37 Wild 14 Wilkes 40 Williams 14,26,38 Wilson 1, 14, 15, 16, 17, 18, 31,42 Womack 26 Wood 5, 25, 38 Woodfin 16 Wooten 14 Young 8, 9,38, 39 Zachary 42 ^J ^J K J 48 _ • MEMBERSHIP Membership in the Jackson County Genealogical Society is open to all individuals who apply and pay dues. Membership is based on the calendar year and dues are paid in advance. Members joining late in the year will receive back issues of the society's journal for that year. ^ Annual dues are $20 for individuals and $25 for family memberships, memberships are available based on age: Individual lifetime 16-29 30-39 40-49 50-59 $350 300 250 200 60-69 70-79 80+ $150 100 50 APPLICATION FOR MEMBERSHIP C New Renewal Life Name Amount Paid • Address Citv Phone State Zip Code E - mail address Families or Areas of Interest Make check payable to JCGS, Inc., and mail to: P. O. Box 2108, Cullowhee NC 28723 u u J C G S , Inc. P . O . B o x 2 1 08 C u l l o w h e e , N C 2 8 7 23 h t t p : / / w w w j c n c g s . c om O f f i c e a n d r e s e a r c h l i b r a r y at t h e J a c k s o n C o u n t y C o u r t H o u se T e l e p h o n e : 8 2 8 - 6 3 1 - 2 6 46 e - m a i l a d d r e s s : j a c k s o n g e n e a l o g y @ d n e t . n et

Related items

Part of Collection

Journeys Through Jackson

Journeys Through Jackson is the official journal of the Jackson County Genealogical Society.  ...

View collection Read introduction
panzoom image
converted_cover_pdf